eRAM
encyclopedia of Rare Disease Annotation for Precision Medicine
| cleidocranial dysplasia | ||||
| Disease ID | 107 |
|---|---|
| Disease | cleidocranial dysplasia |
| Definition | Autosomal dominant syndrome in which there is delayed closing of the CRANIAL FONTANELLES; complete or partial absence of the collarbones (CLAVICLES); wide PUBIC SYMPHYSIS; short middle phalanges of the fifth fingers; and dental and vertebral anomalies. |
| Synonym | ccd ccd - cleidocranial dysplasia clcd clcd - cleidocranial dysplasia cleidocranial digital dysostoses cleidocranial digital dysostosis cleidocranial dysostoses cleidocranial dysostosis cleidocranial dysostosis (disorder) cleidocranial dysplasia [disease/finding] cleidocranial dysplasias craniocleidodysostosis dysostoses, cleidocranial dysostoses, cleidocranial digital dysostosis cleidocranial dysostosis, cleidocranial dysostosis, cleidocranial digital dysplasia, cleidocranial dysplasias, cleidocranial marie sainton syndrome marie-sainton syndrome osteodental dysplasia scheuthauer marie sainton syndrome scheuthauer-marie-sainton syndrome syndrome, marie-sainton syndrome, scheuthauer-marie-sainton |
| Orphanet | |
| OMIM | |
| DOID | |
| UMLS | C0008928 |
| MeSH | |
| SNOMED-CT | |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Text Mined Gene | Entrez_id | Symbol | Score | Resource(Total Genes:47) 176 | ACAN | 1.35 | DISEASES 103 | ADAR | 1.291 | DISEASES 249 | ALPL | 2.087 | DISEASES 54880 | BCOR | 1.507 | DISEASES 632 | BGLAP | 3.248 | DISEASES 650 | BMP2 | 1.876 | DISEASES 865 | CBFB | 3.22 | DISEASES 1435 | CSF1 | 1.953 | DISEASES 1499 | CTNNB1 | 1.342 | DISEASES 9820 | CUL7 | 2.45 | DISEASES 2260 | FGFR1 | 1.27 | DISEASES 2263 | FGFR2 | 1.253 | DISEASES 2261 | FGFR3 | 1.262 | DISEASES 51343 | FZR1 | 2.577 | DISEASES 2778 | GNAS | 1.442 | DISEASES 3590 | IL11RA | 2.644 | DISEASES 3665 | IRF7 | 1.188 | DISEASES 3980 | LIG3 | 2.654 | DISEASES 5606 | MAP2K3 | 1.413 | DISEASES 5608 | MAP2K6 | 1.862 | DISEASES 5600 | MAPK11 | 1.846 | DISEASES 79104 | MEG8 | 1.254 | DISEASES 4487 | MSX1 | 2.295 | DISEASES 4745 | NELL1 | 2.275 | DISEASES 4773 | NFATC2 | 1.408 | DISEASES 579 | NKX3-2 | 4.252 | DISEASES 5083 | PAX9 | 1.828 | DISEASES 26227 | PHGDH | 1.064 | DISEASES 5727 | PTCH1 | 1.249 | DISEASES 8643 | PTCH2 | 1.787 | DISEASES 5745 | PTH1R | 1.143 | DISEASES 83695 | RHNO1 | 1.534 | DISEASES 81847 | RNF146 | 2.921 | DISEASES 860 | RUNX2 | 7.738 | DISEASES 864 | RUNX3 | 3.936 | DISEASES 9353 | SLIT2 | 1.53 | DISEASES 6586 | SLIT3 | 1.398 | DISEASES 4089 | SMAD4 | 1.138 | DISEASES 4090 | SMAD5 | 1.718 | DISEASES 6696 | SPP1 | 1.33 | DISEASES 6708 | SPTA1 | 1.014 | DISEASES 8464 | SUPT3H | 3.664 | DISEASES 6932 | TCF7 | 2.06 | DISEASES 202500 | TCTE1 | 3.285 | DISEASES 7227 | TRPS1 | 2.82 | DISEASES 117581 | TWIST2 | 1.705 | DISEASES 25937 | WWTR1 | 1.637 | DISEASES |
| Locus | Symbol | Locus(Total Locus:1) RUNX2 | 6p21.1 |
| Disease ID | 107 |
|---|---|
| Disease | cleidocranial dysplasia |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:55) HP:0000894 | Short clavicles HP:0000670 | Carious teeth HP:0011800 | Midface retrusion HP:0001810 | Dystrophic toenail HP:0000682 | Abnormality of dental enamel HP:0000239 | Large fontanelles HP:0010751 | Chin dimple HP:0004322 | Short stature HP:0000246 | Sinusitis HP:0008821 | Hypoplastic inferior ilia HP:0000365 | Hearing impairment HP:0000248 | Brachycephaly HP:0005930 | Abnormality of epiphysis morphology HP:0002645 | Wormian bones HP:0005280 | Depressed nasal bridge HP:0000337 | Broad forehead HP:0002644 | Abnormality of pelvic girdle bone morphology HP:0001156 | Brachydactyly syndrome HP:0002205 | Recurrent respiratory infections HP:0011219 | Short face HP:0000347 | Micrognathia HP:0002652 | Skeletal dysplasia HP:0000303 | Mandibular prognathia HP:0002007 | Frontal bossing HP:0003298 | Spina bifida occulta HP:0000316 | Hypertelorism HP:0001172 | Abnormality of the thumb HP:0000164 | Abnormality of the teeth HP:0000684 | Delayed eruption of teeth HP:0000774 | Narrow chest HP:0000772 | Abnormality of the ribs HP:0004331 | Decreased skull ossification HP:0000175 | Cleft palate HP:0005107 | Abnormality of the sacrum HP:0000256 | Macrocephaly HP:0001163 | Abnormality of the metacarpal bones HP:0002650 | Scoliosis HP:0000162 | Glossoptosis HP:0000389 | Chronic otitis media HP:0000939 | Osteoporosis HP:0001182 | Tapered finger HP:0002757 | Recurrent fractures HP:0002857 | Genu valgum HP:0004209 | Clinodactyly of the 5th finger HP:0200021 | Down-sloping shoulders HP:0002705 | High, narrow palate HP:0008391 | Dystrophic fingernails HP:0002812 | Coxa vara HP:0010807 | Open bite HP:0000364 | Hearing abnormality HP:0010535 | Sleep apnea HP:0011069 | Increased number of teeth HP:0000882 | Hypoplastic scapulae HP:0010669 | Cheekbone underdevelopment HP:0000340 | Sloping forehead |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:7) |
| Disease ID | 107 |
|---|---|
| Disease | cleidocranial dysplasia |
| Manually Symptom | UMLS | Name(Total Manually Symptoms:4) |
| Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:1) |
Manually Genotype(Total Manually Genotypes:2) | |||
|---|---|---|---|
| Gene | Mutation | DOI | Article Title |
| RUNX2 | c.674G>A, p.R225Q | doi:10.1038/gim.2015.129 | Comprehensive genetic exploration of skeletal dysplasia using targeted exome sequencing |
| RUNX2 | c.913delT, p.S305PfsX3 | doi:10.1038/gim.2015.129 | Comprehensive genetic exploration of skeletal dysplasia using targeted exome sequencing |
Text Mining Genotype(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
All Snps(Total Genotypes:13) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs104893988 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45512277 | G | A |
| rs104893989 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45431963 | T | C,G |
| rs104893990 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45432011 | G | A |
| rs104893991 | 24634175 | 860 | RUNX2 | umls:C0008928 | BeFree | Role of the RUNX2 p.R225Q mutation in cleidocranial dysplasia: a rare presentation and an analysis of the RUNX2 protein structure. | 0.606148626 | 2014 | RUNX2 | 6 | 45438040 | G | A |
| rs104893991 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45438040 | G | A |
| rs104893992 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45438039 | C | T |
| rs104893993 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45437964 | A | G |
| rs104893994 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45547304 | G | C |
| rs104893995 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45431945 | G | A,C |
| rs397515537 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45546910 | C | T |
| rs397515538 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45422624 | - | C |
| rs730880313 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45422723 | GCAGCAACAGCAGCA | ACAGCAGCAGCAGCAGCAGCAACAGCAGCCG |
| rs730880315 | NA | 860 | RUNX2 | umls:C0008928 | CLINVAR | NA | 0.606148626 | NA | RUNX2 | 6 | 45546967 | - | C |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:23) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0000670 | Carious teeth | MP:0004033 | supernumerary teeth | occurrence of more than the usual number of teeth |
| HP:0002645 | Wormian bones | MP:0008915 | fused carpal bones | anomaly of the nine nodular bones of the joint between the forelimb bones and the front paws/hands resulting in some or all the bones being joined together |
| HP:0005930 | Abnormality of epiphysis morphology | MP:0013621 | decreased internal diameter of femur | reduced cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0001172 | Abnormality of the thumb | MP:0006241 | abnormal placement of pupils | abnormal location of the pupil so that it is not in the center of the iris |
| HP:0000772 | Abnormality of the ribs | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0000774 | Narrow chest | MP:0004134 | abnormal chest morphology | any structural anomaly of the part of the body between the neck and the abdomen |
| HP:0005280 | Depressed nasal bridge | MP:0013582 | abnormal lateral nasal gland morphology | any structural anomaly of the lateral nasal glands (the largest nasal secretory glands in rodents) which surround the maxillary sinus located in the lateral wall adjacent to each nasal passage and are characterized by cytologic features similar to those d |
| HP:0002644 | Abnormality of pelvic girdle bone morphology | MP:0013620 | increased internal diameter of femur | increased cross-sectional distance that extends from one lateral edge of the femur long bone marrow cavity, through its center and to the opposite lateral edge of the bone marrow cavity through the mid point of the femur |
| HP:0004209 | Clinodactyly of the 5th finger | MP:0011665 | d-loop transposition of the great arteries | complete transposition of the great arteries; the d- refers to the dextroposition of the bulboventricular loop (ie, the position of the right ventricle, which is on the right side); in addition, the aorta also tends to be on the right and anterior, and th |
| HP:0011800 | Hypoplasia of midface | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0001163 | Abnormality of the metacarpal bones | MP:0012069 | abnormal horizontal basal cell of olfactory epithelium morphology | any structural anomaly of the flat or angular epithelial cell with condensed nuclei and darkly staining cytoplasm containing numerous intermediate filaments inserted into desmosomes contacting surrounding supporting cells, that lie in contact with the bas |
| HP:0004331 | Decreased skull ossification | MP:0020040 | decreased bone ossification | decrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0002757 | Recurrent fractures | MP:0004675 | rib fractures | a crack or break in the bones forming the bony wall of the chest |
| HP:0000175 | Cleft palate | MP:0013550 | abnormal secondary palate morphology | |
| HP:0005107 | Abnormality of the sacrum | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0003298 | Spina bifida occulta | MP:0005297 | spina bifida occulta | defective closure of the laminae of the vertebral column in the lumbosacral region without hernial protrusion of the spinal cord or meninges; the mildest, most common and often asymptomatic form of spina bifida, identified externally by a skin depression |
| HP:0000684 | Delayed eruption of teeth | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0000682 | Abnormality of dental enamel | MP:0012069 | abnormal horizontal basal cell of olfactory epithelium morphology | any structural anomaly of the flat or angular epithelial cell with condensed nuclei and darkly staining cytoplasm containing numerous intermediate filaments inserted into desmosomes contacting surrounding supporting cells, that lie in contact with the bas |
| HP:0000389 | Chronic otitis media | MP:0001850 | increased susceptibility to otitis media | greater likelihood of middle ear inflammation, with an accumulation of a thick, mucous-like fluid; usually associated with a viral or bacterial respiratory infection |
| HP:0010669 | Hypoplasia of the zygomatic bone | MP:0011205 | excessive folding of visceral yolk sac | the appearance of wrinkles or folds on the surface of the visceral yolk sac |
| HP:0011069 | Increased number of teeth | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0000164 | Abnormality of the teeth | MP:0010382 | abnormal dosage compensation, by inactivation of X chromosome | anomaly in the process of compensating for the two-fold variation in X-chromosome:autosome ratios between sexes by a global inactivation of all, or most of, the genes on one of the X-chromosomes in the XX sex |
| HP:0002205 | Recurrent respiratory infections | MP:0014182 | decreased respiratory epithelial sodium ion transmembrane transport | decrease in the directed movement of sodium ions from one side of the respiratory epithelial cell membrane to the other |
Mapped by homologous gene(Total Items:54) | ||||
|---|---|---|---|---|
| HP ID | HP Name | MP ID | MP Name | Annotation |
| HP:0002650 | Scoliosis | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002645 | Wormian bones | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0005930 | Abnormality of epiphysis morphology | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001172 | Abnormality of the thumb | MP:0014040 | increased cellular sensitivity to DNA damaging agents | greater incidence of cell death following exposure to agents that cause DNA damage |
| HP:0000164 | Abnormality of the teeth | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000774 | Narrow chest | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000303 | Mandibular prognathia | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0002205 | Recurrent respiratory infections | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0001810 | Dystrophic toenail | MP:0013241 | embryo tissue necrosis | morphological changes resulting from pathological death of some or all embryo tissue; usually due to irreversible damage |
| HP:0010751 | Chin dimple | MP:0013767 | decreased palatal rugae number | reduced number of transverse folds (ridges) of the mucosa located on the anterior third part of the secondary (hard) palate of most mammalian species |
| HP:0000882 | Hypoplastic scapulae | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0004322 | Short stature | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0000682 | Abnormality of dental enamel | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000347 | Micrognathia | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000364 | Hearing abnormality | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002705 | High, narrow palate | MP:0013600 | testis degeneration | a retrogressive impairment of function or destruction of either or both of the male reproductive glands |
| HP:0000316 | Hypertelorism | MP:0020321 | increased vascular endothelial cell apoptosis | increase in the timing or the number of vascular endothelial cells undergoing programmed cell death |
| HP:0000772 | Abnormality of the ribs | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0001182 | Tapered finger | MP:0014178 | increased brain apoptosis | increase in the number of cells of the brain undergoing programmed cell death |
| HP:0000340 | Sloping forehead | MP:0020040 | decreased bone ossification | decrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance |
| HP:0000894 | Short clavicles | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0008821 | Hypoplastic inferior ilia | MP:0011094 | embryonic lethality before implantation, complete penetrance | death of all organisms of a given genotype in a population between fertilization and implantation (Mus: E0 to less than E4.5) |
| HP:0000248 | Brachycephaly | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000337 | Broad forehead | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0005280 | Depressed nasal bridge | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000939 | Osteoporosis | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002857 | Genu valgum | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0001156 | Brachydactyly syndrome | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000670 | Carious teeth | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002757 | Recurrent fractures | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0200021 | Down-sloping shoulders | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000175 | Cleft palate | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0005107 | Abnormality of the sacrum | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0002812 | Coxa vara | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0000162 | Glossoptosis | MP:0013292 | embryonic lethality prior to organogenesis | death prior to the completion of embryo turning (Mus: E9-9.5) |
| HP:0000365 | Hearing impairment | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0010807 | Open bite | MP:0013696 | increased granulocyte monocyte progenitor cell number | increase in the number of a hematopoietic progenitor cell that is committed to the granulocyte and monocyte lineages; these cells are CD123-positive, and do not express Gata1 or Gata2 but do express C/EBPa, and Pu.1 |
| HP:0000246 | Sinusitis | MP:0020186 | altered susceptibility to bacterial infection | a change in the likelihood that an organism will develop ill effects from a bacterial infection or from components of or toxins produced by bacteria |
| HP:0001163 | Abnormality of the metacarpal bones | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0002652 | Skeletal dysplasia | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0000684 | Delayed eruption of teeth | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0003298 | Spina bifida occulta | MP:0020137 | decreased bone mineralization | decrease in the rate at which minerals are deposited into bone |
| HP:0004209 | Clinodactyly of the 5th finger | MP:0020157 | abnormal behavioral response to alcohol | any anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior |
| HP:0000389 | Chronic otitis media | MP:0014185 | cerebellum atrophy | acquired diminution of the size of the cerebellum associated with wasting as from death and reabsorption of cells, diminished cellular proliferation, decreased cellular volume, pressure, ischemia, malnutrition, reduced function or malfunction, or hormonal |
| HP:0000256 | Macrocephaly | MP:0020309 | increased creatine kinase activity | increased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+). |
| HP:0011800 | Hypoplasia of midface | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0004331 | Decreased skull ossification | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002644 | Abnormality of pelvic girdle bone morphology | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0011069 | Increased number of teeth | MP:0020010 | decreased bone mineral density of femur | reduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh |
| HP:0010669 | Hypoplasia of the zygomatic bone | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| HP:0002007 | Frontal bossing | MP:3000003 | abnormal Ebner's gland morphology | any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l |
| HP:0010535 | Sleep apnea | MP:0020220 | decreased tear production | decreased production of the amount of fluid produced in the eye |
| HP:0008391 | Dystrophic fingernails | MP:0013781 | abnormal mammary gland luminal epithelium morphology | any structural anomaly of the inner cell layer of the mammary epithelium bilayer that lines the luminal surface of mammary gland ducts and alveoli; luminal cells have only limited contact with the underlying basement membrane and surrounding connective ti |
| HP:0000239 | Large fontanelles | MP:0020254 | decreased collagen level | decreased level of the main structural protein of the various connective tissues in animals |
| Disease ID | 107 |
|---|---|
| Disease | cleidocranial dysplasia |
| Case | (Waiting for update.) |